brianogle7707 brianogle7707
  • 17-07-2019
  • Computers and Technology
contestada

A diskette is divided into concentric circles known as______.

Respuesta :

sanchezmonica
sanchezmonica sanchezmonica
  • 29-07-2019

Answer:

Tracks

Explanation:

A disk is divided into thin concentric circles called tracks. The heads move between the outermost track or zero track to the innermost track.

It is the circular path drawn through the circular surface of the disk plate by the read / write head.

Each track consists of one or more Cluster.

Answer Link

Otras preguntas

Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’
Ultimately, how did President Woodrow Wilson contribute to the failure to the treaty to pass in the Senate?
Choose the best conjugation of ir to tell who is going where this morning. nosotros _____ al aeropuerto.
How many cords of wood could you fit in a room that is 4 yards long 4 yards wide and 2 yards high?
What’s the answer ??? (ONLY ANSWER IF YOU KNOW)
Northern China built the Great Wall to protect itself from the invasions of the nomads
how can writers add variety to their writing?
I need to know the area of the shape base 1 (27ft) base 2(34ft) Height (12ft)
Cyrus McCormick invented the ____________ which revolutionized the farming industry. a. fertilizer machine c. mechanical tractor b. mechanical reaper d. none of
(98 – 37 + 15 ÷ 3) × 2 ÷ 3