Arielmarierodriguez Arielmarierodriguez

21-01-2021
Chemistry

contestada

What are the four season of the northern hemisphere .

Respuesta :

petilavonta2008 petilavonta2008

21-01-2021

Answer:

spring, summer, fall, and winter

Answer Link

theone54 theone54

21-01-2021

Answer:

fall,winter,spring,summer

Explanation:

if you want you can go to safri

Answer Link

Otras preguntas

You are shopping online for a new TV. The one you want costs $2,500. You live in New York where the state sales tax rate is 8.49%. Your sister lives a short dis

Create a function (prob3_6) that will do the following: Input a positive scalar integer x. If x is odd, multiply it by 3 and add 1. If the given x is even, divi

Michal has a T-shirt that glows in the dark he holds his T-shirt up to light source and then turns off the light his T-shirt continues to glow. Explain this phe

What is the central idea that Truth conveys through her "Ain't I a Woman?" speech? All women deserve to be helped into carriages and given the best of everythin

what is the remainder of 14952 divided by 41 plzzzzz help ASAP will give brainiest answer

What are the divisions of florida's constitution?

solve the simultaneous equations y=x-2 and y=3x+5

A person places a cup of coffee on the roof of her car while she dashes back into the house for a forgotten item. When she returns to the car, she hops in and t

The amplitudes and phase differences for four pairs of waves of equal wavelengths are (a) 2 mm, 6 mm, and π rad; (b) 3 mm, 5 mm, and π rad; (c) 7 mm, 9 mm, and

GUAAUGAAACGCCUGGUAGAAGGUUGAUGC 1. List the DNA strand sequence from which the mRNA was transcribed: 2. List the complementary DNA sequence to the above DNA stra