aherrin005 aherrin005

17-02-2021
Mathematics

contestada

which is an equivalent ratio to 7:5
A: 14:12
B:21:10
D:21:15

Respuesta :

yessahblessah12345 yessahblessah12345

17-02-2021

Answer:

b

Step-by-step explanation:

Answer Link

mpk2008 mpk2008

17-02-2021

I think it’s B too because I think so

Answer Link

Otras preguntas

Significance of the following events in british north america: The Great Migration P.E.I’s Absence Landlords Industrialization in Canada East

Who was the 36th president of the U.S.?

Part 1: CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks :3

- May affect all nations of Southern and Eastern Asia - Alters monsoon patterns, increases human respiratory problems, and reduces solar radiation to Earth's su

what is the simplified form of (3.25*10^3)(7.8*10^6) written in scientific notation

What two gasses probably dominated Precambrian Earth's atmosphere

"Our policy in regard to Europe ... remains the same, which is, not to interfere in the internal concerns of any of its powers."—President James Monroe, speech

A ddr4 dimm with a pc rating of pc4-17000 is running at what speed?

what did the us do about the holocaust

HELP!! What is the twentieth term of the arithmetic sequence 21, 18, 15, 12, ... ? 1 78 -39 -36