explainedmars12 explainedmars12
  • 17-02-2021
  • Social Studies
contestada

What distinction could the Harlem Hell Fighters claim?

Respuesta :

aestheticpink321
aestheticpink321 aestheticpink321
  • 09-03-2021

Answer:

they helped with citizenship

Explanation:

Answer Link

Otras preguntas

A patient who has undergone an open cholecystectomy 12 hours prior has a jackson-pratt (jp) drain. the nurse empties the drainage and notes bile-stained serosan
Solve. Write or draw to explaind. Grace has $1.10 she spends 75€ on a toy. How much change did she get back?
Please help with these physics questions (11-15)
What percent of 120 is 78?
How did Jordan’s annexation of the West Bank and East Jerusalem after the war of 1948 affect that country?
An airplane reaches its cruising hight. at this height it travels at a constant speed, or rate and travels 2,000 mile in 4 hours. What is the rate of the plane?
Find the midpoint of the line segment whose endpoints are (3, 10) and (7, 8).
Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’
Is there any particular pattern among genomes and the organisms who have them?
In one to two sentences, describe one method for launching or opening a program.