aeva4157 aeva4157
  • 17-03-2021
  • Mathematics
contestada

-2/5 w+11 2/5=9 4/5 solve for w please

Respuesta :

cwrw238 cwrw238
  • 17-03-2021

Answer:

w = 4.

Step-by-step explanation:

-2/5 w+11 2/5=9 4/5

-2/5w + 57/5 = 49/5

Remove the fractions by multiplying thru by 5:

-2w + 57 = 49

-2w = 49 - 57

-2w = -8

w = 4.

Answer Link
980074972
980074972 980074972
  • 17-03-2021

Answer:

w=  -8/5

Step-by-step explanation:

Answer Link

Otras preguntas

Determine the heat released when 36.0 g of water condenses at 100 degrees celsius.
Help me plssssssss ( i need 20 characters)
According to the communication process, who provides information?
Based on the following passage, which of these structures is likely to have the shortest lifespan? Buildings sometimes live—and are lived in—for hundreds of yea
What did Missionary Warner give the robber? Select all that apply. clocks watches money food
The owner of a men’s store bought 150 suits for a total of $32,500. If he wishes to sell them for at least $66,000, how much per suit should he charge?
Transribe and translate the following dna strand GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT
What point on the number line is 1/5 of the way from the point -7 to the point 17? A. -2.2 B. 1.4 C. 2.0 D. 12.2​
Help!! Have no clue where to start due tomorrow morning
Please help! I’m really bad at math