foodhow
foodhow foodhow
  • 18-03-2021
  • Social Studies
contestada

please help me i need this to help my grade

please help me i need this to help my grade class=

Respuesta :

nMRSMITHewww nMRSMITHewww
  • 18-03-2021

Answer:

c

Explanation:

Answer Link

Otras preguntas

The force F of attraction between two bodies varies jointly as the weights of the two bodies and inversely as the square of the distance d between them. Express
I think it is C but im not sure
Which statement is true of the Manhattan Project? all of these code name for secret research and development program to build an atomic bomb during WWII Albert
A small company’s net income for the first six months of the year was 76,500 and for the last six months it was 100,000. What is the ratio of the first six mont
Based on the urine color and specific gravity what might Tracey conclude about the hydration status of max body at the three different times
Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’
Rocks are solids composed of one or more minerals true or false
Holly rode her bike for 24 miles at 6 miles per hour. She finished her ride at 1:00 p.m. Which explanation correctly tells how to calculate what time Holly sta
Please select the correct definition for the given word Harappa
What is the main job of a party whip?