cdcdcd058 cdcdcd058

16-09-2021
Geography

contestada

The ______________ was(were) created by coral reefs and they have no rivers. Bahamas
Cuba
Haiti
Mexico

Respuesta :

fabodagoat fabodagoat

16-09-2021

i think it’s the bahamas

Answer Link

beautyqueendex beautyqueendex

16-09-2021

Answer:

Its is the bahamas

Explanation: i took the test

Answer Link

Otras preguntas

GUAAUGAAACGCCUGGUAGAAGGUUGAUGC 1. List the DNA strand sequence from which the mRNA was transcribed: 2. List the complementary DNA sequence to the above DNA stra

Flint Company sold 202 color laser copiers on July 10, 2020, for $3,720 apiece, together with a 1-year warranty. Maintenance on each copier during the warranty

Hunter had seven gallons of water in the refrigerator. Of those, two and one-fourth gallons were spring water and one and one-fifth gallons were filtered water.

It is not necessary to read credit contracts and agreements before signing them because they all have the same terms. false true

Writing a screenplay in Monster gives Steve Harmon a more accurate view of his situation because it

If A={3,6,9,12 }and B={0,4,8,12}, then find A∩B. *

A linear function has a slope of -7 /9 and a y-intercept of 3. How does this function compare to the linear function that is represented by the equation y + 11

surface area, will mark brainliest.

which types of stars are thought to be the source for enriching the universe with heavy elements? Explain why

need help on these problems plz its for a grade