marian4439 marian4439
  • 17-11-2021
  • Social Studies
contestada

What do you think about washington's decision to pick jefferson and hamilton as cabinet members

Respuesta :

bakert18518
bakert18518 bakert18518
  • 18-11-2021

Answer: Hamilton the first secretary of the Treasury.

Explanation:

Although both men had been active in the Revolutionary effort and in the founding of the United States, Jefferson and Hamilton did not work together until Washington appointed Jefferson the first secretary of State

Answer Link

Otras preguntas

If you flip a coin two times, what are the different outcomes that will occur? * Heads, Tails Heads, Heads; Heads, Tails Tails, Tails, Tails, Heads Heads, Heads
When solving 4x – 3 = 5, the property used in the first step is the ________ property of equality. Question 13 options: A) transitive B) division C) substitutio
who is our cabinet minister of India​
A stiff wire 32.5 cm long is bent at a right angle in the middle. One section lies along the z axis and the other is along the line y=2x in the xy plane. A curr
QUESTION 5 What is the area of the trapezoid?
Flow Company has provided the following information for the year ended December 31, 2014:Cash paid for interest $20,000Cash paid for dividends $6,000Cash divide
HELP ASAP!!! Please help me answer these questions!
what can a reader infer about Iroquios culture from the passage ? Check three best answers
GUAAUGAAACGCCUGGUAGAAGGUUGAUGC 1. List the DNA strand sequence from which the mRNA was transcribed: 2. List the complementary DNA sequence to the above DNA stra
Describe the relationship between humans and the natural environment