assseater
assseater assseater
  • 18-12-2021
  • Mathematics
contestada

help pls the image below represents ____

help pls the image below represents class=

Respuesta :

frodriguez2074 frodriguez2074
  • 18-12-2021

Answer:

I think it's a Box Plot, hope this helps

Answer Link

Otras preguntas

What is the definition of mass ?
Player Physical Science A (Fowler Savage) English Match each change of state with its description freezing vaporization that occurs below the surface of a liqui
All corresponding sides are proportional (same ratio) in similar figures. True or False
An 81-year-old woman with RA) has been controlled with methotrexate for 18 years. Recently she experienced increased joint pain and swelling in her right knee t
GUAAUGAAACGCCUGGUAGAAGGUUGAUGC 1. List the DNA strand sequence from which the mRNA was transcribed: 2. List the complementary DNA sequence to the above DNA stra
Each person in Plimouth was given a plot of land 16.7 m wide by 40.8 m long. The Alden family had four members. What was the square area of the plot of land the
Plz help me this is due in 45mins
What is the name given to the struggle between the US in the USSR at the end of World War II
9b-4-56-7 Your answer
Need help what’s the solution for b^2-14b=0