WindsorLynne WindsorLynne

20-02-2017
Spanish

contestada

Do conditions and circumstances that surrounded the event in the past require the imperfect or the preterite?

imperfect
preterite

Respuesta :

jamesbond3147 jamesbond3147

20-02-2017

okay, the preterite is used for an event happening once while the imperfect is used for when it happen's over and over. so what event are you talking about?

Answer Link

Otras preguntas

I WILL GIVE BRAINLY IF U HELP ME WITH THIS LITTLE PASSAGE The Earth is made up of three main layers called the crust, mantle and core. The crust is the thin,

If warmer oceans soak up less CO2, what effect do you think rising ocean temperatures will have on the amount of CO2 in the atmosphere ?

Which statement best explains why an object appears green in sunlight? A- The object absorbs most white light and refracts most green light. B- The object refr

As a metal such as lead is heated past its melting point, what happens to the average kinetic energy of the atoms

Here is the English version

When Greenway,Inc.sells 48,000 units,its total fixed cost is $115,200.What is its total fixed cost when it sells 54,000 units? A) $100,800 B) $115,200 C) $129,6

Coding of a Polypeptide by Duplex DNA The template strand of a segment of double-helical DNA contains the sequence (59)CTTAACACCCCTGACTTCGCGCCGTCG(39) (a) What

Let's review. What can be stored in a variable? Why is using a meaningful name for the variable important?

The students at Midtown Middle school sold flowers as a fundraiser in September and October. In October, they charged $1.50 for each flower. The October price w

Steinbeck uses the setting of this chapter to help mirror the opening of the book. In particular, he uses phrases and images that are similar to both: for examp